ID: 1019779288_1019779294

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1019779288 1019779294
Species Human (GRCh38) Human (GRCh38)
Location 7:2930079-2930101 7:2930105-2930127
Sequence CCTCACGGGAGACGAGATGGGAG CAGAGAAAGGAGAAGGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 67} {0: 1, 1: 0, 2: 11, 3: 143, 4: 1401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!