ID: 1019787161_1019787167

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1019787161 1019787167
Species Human (GRCh38) Human (GRCh38)
Location 7:2984372-2984394 7:2984406-2984428
Sequence CCTTCAAACTCTGGGACTGACAC TTGTTTTCGGACCTTCAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 41, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!