|
Left Crispr |
Right Crispr |
| Crispr ID |
1019788694 |
1019788705 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:2996440-2996462
|
7:2996463-2996485
|
| Sequence |
CCAGCTCCCCCCAACCCCACCCA |
CACCAAAAGCTGCCACTGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 23, 3: 307, 4: 2384} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|