ID: 1019794559_1019794563

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1019794559 1019794563
Species Human (GRCh38) Human (GRCh38)
Location 7:3040251-3040273 7:3040281-3040303
Sequence CCAAAAGACGGAATGCTGCTGGA CCTGCAAAGCAGATAGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88} {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!