ID: 1019842025_1019842032

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1019842025 1019842032
Species Human (GRCh38) Human (GRCh38)
Location 7:3456851-3456873 7:3456877-3456899
Sequence CCCCTTAGTTAGGTTTAGCACTC TTCTGGCCTGCTTTTGTGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 21, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!