ID: 1019867604_1019867609

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1019867604 1019867609
Species Human (GRCh38) Human (GRCh38)
Location 7:3727473-3727495 7:3727518-3727540
Sequence CCTCTTTTTGCCAGGGAGAGAAT CCTCGCTCTGTCACTCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 223} {0: 22, 1: 1339, 2: 28920, 3: 125242, 4: 166288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!