ID: 1019874745_1019874746

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1019874745 1019874746
Species Human (GRCh38) Human (GRCh38)
Location 7:3799780-3799802 7:3799793-3799815
Sequence CCTGAGTTTACTTGCTCCTCCAA GCTCCTCCAAATGCTAAATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!