ID: 1019896444_1019896456

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1019896444 1019896456
Species Human (GRCh38) Human (GRCh38)
Location 7:3987202-3987224 7:3987245-3987267
Sequence CCTCAGAACCTCCTGGTCAGCCC CCGTGGTGCTCTCTTGGGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 243} {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!