ID: 1019897339_1019897345

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1019897339 1019897345
Species Human (GRCh38) Human (GRCh38)
Location 7:3992475-3992497 7:3992505-3992527
Sequence CCAGGTGGCGGATGAGGGAAGCC TCCCTGCATTGAGAGAGTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!