ID: 1019907206_1019907219

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1019907206 1019907219
Species Human (GRCh38) Human (GRCh38)
Location 7:4073914-4073936 7:4073947-4073969
Sequence CCCTAGTGCTCAGGCCCCTCTCC TAGGCTGAGCACTATGGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 8, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!