ID: 1019907370_1019907379

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1019907370 1019907379
Species Human (GRCh38) Human (GRCh38)
Location 7:4074991-4075013 7:4075008-4075030
Sequence CCTTCTCCCCTCTCCCTGGGAGG GGGAGGAGGAAAAGGAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 85, 4: 685} {0: 1, 1: 0, 2: 11, 3: 122, 4: 1351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!