ID: 1019919574_1019919582

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1019919574 1019919582
Species Human (GRCh38) Human (GRCh38)
Location 7:4154914-4154936 7:4154938-4154960
Sequence CCAAAATCCATGCTCTGCCACAG AGGGAGCATGGCAGGAGCAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 248} {0: 1, 1: 2, 2: 8, 3: 81, 4: 787}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!