ID: 1019919952_1019919966

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1019919952 1019919966
Species Human (GRCh38) Human (GRCh38)
Location 7:4157223-4157245 7:4157275-4157297
Sequence CCCATTGCATGTGGAGTAGCTGG TGAAGGAGGGGAAGGAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109} {0: 1, 1: 1, 2: 75, 3: 784, 4: 5833}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!