ID: 1019930342_1019930350

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1019930342 1019930350
Species Human (GRCh38) Human (GRCh38)
Location 7:4218661-4218683 7:4218680-4218702
Sequence CCATTTCTTAGGGCTGACAGCAG GCAGGAGGGCAGGGCTGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139} {0: 1, 1: 4, 2: 35, 3: 314, 4: 1935}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!