ID: 1019931313_1019931323

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1019931313 1019931323
Species Human (GRCh38) Human (GRCh38)
Location 7:4225172-4225194 7:4225213-4225235
Sequence CCCATGTCCCAGTTGTGAGACTG TGTTACCACTGGGGGACACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 17, 2: 82, 3: 216, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!