ID: 1019959378_1019959382

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1019959378 1019959382
Species Human (GRCh38) Human (GRCh38)
Location 7:4446227-4446249 7:4446256-4446278
Sequence CCCAGTGCCCTCTTTTCAAGGTG ATTCAATCTCAGCTACCTCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!