ID: 1019993122_1019993133

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1019993122 1019993133
Species Human (GRCh38) Human (GRCh38)
Location 7:4706359-4706381 7:4706405-4706427
Sequence CCCTAAGTTAGGAGTTTATATCT AACAGCAAGGGGAGGTGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!