ID: 1019999076_1019999084

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1019999076 1019999084
Species Human (GRCh38) Human (GRCh38)
Location 7:4744691-4744713 7:4744726-4744748
Sequence CCCCGTCAGGGGGTGCGAGCAGC CACCTGCCCTGCTCTTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80} {0: 1, 1: 0, 2: 5, 3: 40, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!