ID: 1020001250_1020001257

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1020001250 1020001257
Species Human (GRCh38) Human (GRCh38)
Location 7:4757206-4757228 7:4757254-4757276
Sequence CCGTCCTCCAGCTGTTAGGAAAG ACGTGGCGCAGTCAGCCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 13, 4: 237} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!