ID: 1020005746_1020005751

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1020005746 1020005751
Species Human (GRCh38) Human (GRCh38)
Location 7:4783099-4783121 7:4783114-4783136
Sequence CCAGCCTCAGCGATGCAGCTCCC CAGCTCCCAGGGAGAGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201} {0: 1, 1: 2, 2: 11, 3: 118, 4: 841}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!