ID: 1020007032_1020007040

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1020007032 1020007040
Species Human (GRCh38) Human (GRCh38)
Location 7:4788602-4788624 7:4788629-4788651
Sequence CCGGCCACAGGCCTCCTGCCCTC CACGCCAGCCTTTGTCCCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 738} {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!