ID: 1020007035_1020007047

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1020007035 1020007047
Species Human (GRCh38) Human (GRCh38)
Location 7:4788616-4788638 7:4788659-4788681
Sequence CCTGCCCTCAGCCCACGCCAGCC GTCCCGGGTGTGCTGACGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 113, 4: 891} {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!