ID: 1020014069_1020014090

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1020014069 1020014090
Species Human (GRCh38) Human (GRCh38)
Location 7:4820865-4820887 7:4820911-4820933
Sequence CCCCGCCACCTCCCTCTCACCAC CCTGCCCCTAAGGCATGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 109, 4: 1250} {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!