ID: 1020016656_1020016665

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1020016656 1020016665
Species Human (GRCh38) Human (GRCh38)
Location 7:4835449-4835471 7:4835491-4835513
Sequence CCCGGAGGAGCACACGAGAGACC AGACAGCGACAGGCCAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!