ID: 1020046755_1020046764

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1020046755 1020046764
Species Human (GRCh38) Human (GRCh38)
Location 7:5046198-5046220 7:5046233-5046255
Sequence CCCGAGGGAGGCGGATCTGGGTC CCCGCCTGGATTTGCCCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 138} {0: 1, 1: 4, 2: 3, 3: 7, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!