ID: 1020058119_1020058123

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1020058119 1020058123
Species Human (GRCh38) Human (GRCh38)
Location 7:5132579-5132601 7:5132597-5132619
Sequence CCCTCTCCCAGGCGCAGGTGGGA TGGGAGAAAACCTCCTCTGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!