ID: 1020078631_1020078637

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1020078631 1020078637
Species Human (GRCh38) Human (GRCh38)
Location 7:5274821-5274843 7:5274856-5274878
Sequence CCTTCACCCAGCCCTTTTGACAA AACACTTATCAGGCCCTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 18, 4: 214} {0: 1, 1: 1, 2: 1, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!