ID: 1020080394_1020080405

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1020080394 1020080405
Species Human (GRCh38) Human (GRCh38)
Location 7:5283268-5283290 7:5283293-5283315
Sequence CCCGGCGACAAGCGCGGACCCGG CCCTGGGCCCTCGCCATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 1, 4: 54} {0: 1, 1: 2, 2: 3, 3: 16, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!