ID: 1020085883_1020085892

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1020085883 1020085892
Species Human (GRCh38) Human (GRCh38)
Location 7:5310025-5310047 7:5310070-5310092
Sequence CCCTCGGCCGCCTGAGTTGATGG TATTTTTATTTTTGTAGAGATGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 45, 4: 1479} {0: 149, 1: 635, 2: 6396, 3: 23162, 4: 157955}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!