ID: 1020092212_1020092219

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1020092212 1020092219
Species Human (GRCh38) Human (GRCh38)
Location 7:5348151-5348173 7:5348181-5348203
Sequence CCCCACCAAAAAGAGAGACTGTC AGACACTTGCTTCCAAGGACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!