ID: 1020098436_1020098442

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1020098436 1020098442
Species Human (GRCh38) Human (GRCh38)
Location 7:5381129-5381151 7:5381144-5381166
Sequence CCTGCCACCCTCAGGGCCTCAAG GCCTCAAGGGCCACAGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 369} {0: 1, 1: 0, 2: 1, 3: 28, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!