ID: 1020106376_1020106388

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1020106376 1020106388
Species Human (GRCh38) Human (GRCh38)
Location 7:5424014-5424036 7:5424058-5424080
Sequence CCCACAGCCATTCCTATAAAACC AGCAGTTTCCAGGCTCCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 160} {0: 1, 1: 0, 2: 2, 3: 24, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!