ID: 1020106377_1020106381

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1020106377 1020106381
Species Human (GRCh38) Human (GRCh38)
Location 7:5424015-5424037 7:5424029-5424051
Sequence CCACAGCCATTCCTATAAAACCA ATAAAACCAATTACGGACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 229} {0: 1, 1: 0, 2: 0, 3: 10, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!