ID: 1020106377_1020106383

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1020106377 1020106383
Species Human (GRCh38) Human (GRCh38)
Location 7:5424015-5424037 7:5424031-5424053
Sequence CCACAGCCATTCCTATAAAACCA AAAACCAATTACGGACCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 229} {0: 1, 1: 0, 2: 0, 3: 0, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!