ID: 1020107082_1020107090

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1020107082 1020107090
Species Human (GRCh38) Human (GRCh38)
Location 7:5427112-5427134 7:5427137-5427159
Sequence CCCTCATACTTTTGTTTACCCAG GGATAGGTGGCCAAAAACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 640} {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!