ID: 1020112031_1020112038

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1020112031 1020112038
Species Human (GRCh38) Human (GRCh38)
Location 7:5452617-5452639 7:5452639-5452661
Sequence CCACGCATCAGCCCGGGGAGGCC CCCAGGCCTGGTCAGCCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 48, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!