ID: 1020112031_1020112045

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1020112031 1020112045
Species Human (GRCh38) Human (GRCh38)
Location 7:5452617-5452639 7:5452666-5452688
Sequence CCACGCATCAGCCCGGGGAGGCC GCCCGCCAGGCTCAGCTTCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 26, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!