ID: 1020134364_1020134368

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1020134364 1020134368
Species Human (GRCh38) Human (GRCh38)
Location 7:5578520-5578542 7:5578559-5578581
Sequence CCCGATGAGTCAAACTGTGTTCC TTCACTGAATTTCAAAGAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 36, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!