ID: 1020192313_1020192321

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1020192313 1020192321
Species Human (GRCh38) Human (GRCh38)
Location 7:6009520-6009542 7:6009549-6009571
Sequence CCCAGTGCGCACGCGCGGCGACC TGGCCCGGGTCCCCCCAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 0, 4: 35} {0: 1, 1: 0, 2: 6, 3: 30, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!