ID: 1020204551_1020204569

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1020204551 1020204569
Species Human (GRCh38) Human (GRCh38)
Location 7:6104931-6104953 7:6104981-6105003
Sequence CCCGGATGGAGGCACGTCATTGT GGCGGCGGCGGCGGCGGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77} {0: 31, 1: 1258, 2: 1676, 3: 3019, 4: 6009}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!