ID: 1020204552_1020204565

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1020204552 1020204565
Species Human (GRCh38) Human (GRCh38)
Location 7:6104932-6104954 7:6104966-6104988
Sequence CCGGATGGAGGCACGTCATTGTC GGCTGGGCTGTGTGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56} {0: 1, 1: 0, 2: 4, 3: 49, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!