ID: 1020204552_1020204566

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1020204552 1020204566
Species Human (GRCh38) Human (GRCh38)
Location 7:6104932-6104954 7:6104969-6104991
Sequence CCGGATGGAGGCACGTCATTGTC TGGGCTGTGTGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56} {0: 1, 1: 0, 2: 5, 3: 43, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!