ID: 1020204558_1020204568

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1020204558 1020204568
Species Human (GRCh38) Human (GRCh38)
Location 7:6104954-6104976 7:6104975-6104997
Sequence CCCCCGCCGGGCGGCTGGGCTGT GTGTGCGGCGGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183} {0: 2, 1: 16, 2: 217, 3: 2010, 4: 3792}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!