ID: 1020204558_1020204571

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1020204558 1020204571
Species Human (GRCh38) Human (GRCh38)
Location 7:6104954-6104976 7:6104983-6105005
Sequence CCCCCGCCGGGCGGCTGGGCTGT CGGCGGCGGCGGCGGCCGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183} {0: 3, 1: 26, 2: 188, 3: 578, 4: 1377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!