ID: 1020204560_1020204570

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1020204560 1020204570
Species Human (GRCh38) Human (GRCh38)
Location 7:6104956-6104978 7:6104982-6105004
Sequence CCCGCCGGGCGGCTGGGCTGTGT GCGGCGGCGGCGGCGGCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 178} {0: 1, 1: 29, 2: 411, 3: 653, 4: 1785}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!