ID: 1020211067_1020211079

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1020211067 1020211079
Species Human (GRCh38) Human (GRCh38)
Location 7:6158597-6158619 7:6158649-6158671
Sequence CCCATGGAGTGCTGGGGAAACAG CGGTGAGGACGGGTTGCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 183} {0: 1, 1: 0, 2: 1, 3: 6, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!