ID: 1020214259_1020214266

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1020214259 1020214266
Species Human (GRCh38) Human (GRCh38)
Location 7:6177634-6177656 7:6177666-6177688
Sequence CCCATGGACACGGGAGAGGAACC GGGCTCGCTTGGTATTGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86} {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!