ID: 1020241694_1020241700

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1020241694 1020241700
Species Human (GRCh38) Human (GRCh38)
Location 7:6400148-6400170 7:6400175-6400197
Sequence CCCTTGTGAGTCCTGCATCATTT ATGTCCGTGCAAAGGTAGGTGGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 1, 3: 20, 4: 190} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!