ID: 1020241902_1020241909

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1020241902 1020241909
Species Human (GRCh38) Human (GRCh38)
Location 7:6401689-6401711 7:6401731-6401753
Sequence CCTGAGATGTTCCTTATGGCTCA GAACCACCTGAAGCCTCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 137} {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!