ID: 1020248304_1020248314

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1020248304 1020248314
Species Human (GRCh38) Human (GRCh38)
Location 7:6447720-6447742 7:6447760-6447782
Sequence CCACCGCCCCCGTAGCCGCCGTC ACGACCAGCTCGAAGAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 91, 4: 1666} {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!